Meanwhile, back at the university, Raine was conducting her evening lecture for postgraduate students in Biology. Outside, clusters of undergraduates from the Technology Department roamed the campus, their classes stretching late into the evening like hers.

Raine sat quietly at the back of the lecture hall, her gaze steady on the student presenting at the front. With her hands clasped beneath her chin, she leaned slightly forward, lost in thought yet attentive, her eyes sharp and observant as she took in every word of the report.

"Clustered Regularly Interspaced Short Palindromic Repeats, or CRISPR," Nikki Jaye Watson began, standing confidently before the class, her presentation adorned in a soft pink palette that subtly commanded attention. "This sequence is part of the bacterial genome that produces RNA molecules, while Cas-short for CRISPR-associated protein-refers to a DNA-cutting enzyme."

Her voice remained steady as she continued, "Although earlier gene-editing techniques existed, the CRISPR-Cas system has now become the preferred method for gene modification. Its advantages? It's more efficient, accurate, versatile, and easy to apply. CRISPR-Cas9, in particular, is reshaping the world of genetic science. This tool is not only faster and cheaper than past DNA-editing methods but is also remarkably precise, opening doors to countless applications."

"Yes, I understand the fundamentals," Raine replied with a raised eyebrow. "But I want to hear your understanding of how CRISPR operates. Explain it in a way that reflects the depth of your knowledge. If you can't convey the concept clearly, how will you teach it to others, especially your students?"

Nikki took a steadying breath, her gaze fixed on Raine as she advanced the presentation slide. "Scientists found that around forty percent of bacteria contain clusters of regularly spaced, repeating sequences," she began, her voice trying to become steady. "These sequences, which read the same forwards and backwards, are palindromic."

She gestured to the display, where two sequences were highlighted: "Here, for example, CAATAACTTCAAAAGTATTG, paired with GTTATTGAAGTTTTCATAAC. These palindromic sequences are the CRISPR regions. They act like genetic memories of viral invasions, allowing bacteria to recognize and defend against future attacks by similar viruses."

"Correct-those are palindromes," Raine replied, her gaze intent. "Now, what about the random nitrogen bases between them?"

"They're called spacers, and that's why it's named Clustered Regularly Interspaced Short Palindromic Repeats," Nikki explained, her tone steady, though a hint of uncertainty lingered.

Raine tilted her head slightly, her eyes probing. "Alright, but what's the significance of these spacers? Why do they exist between the repeats?"

"Erm... at first, they concentrated on the palindromic repeats, but then... the real secret lay in the spacers," she answered.

"Go on," Raine urged.

"There was a scientist, Francisco Mojica from Spain, who discovered that these spacers matched DNA found in viruses, specifically bacteriophages," Nikki explained. "It turned out that CRISPR acts as a kind of immune system for bacteria. During a bacteriophage infection, the bacterium can snip a segment of viral DNA and insert it into its own genome, creating a memory of the invader to better defend against it in future attacks."

"Alright, but could you put it more simply?" Raine asked.

Nikki paused, considering her words. "Ms. Watson?" Raine prompted. "Perhaps an anagram or something similar?"

"Alright, so... imagine you're typing a document," Nikki began. "To spot a misspelled word, you might press F7 or use the spell check feature to find it. Once found, you can edit or delete it. For DNA, that's essentially what CRISPR/Cas9 does."

She clicked to reveal a bean-shaped figure on the screen. "CRISPR has two parts. First, there's Cas9, a protein that cuts the DNA. Then, there's the Guide RNA, which recognises the specific DNA sequence to be edited," Nikki explained.

"Let's start with the Cas9 system," Raine said, gesturing for Nikki to look at her classmates, who were listening intently but avoiding her gaze as she addressed the reporter.

"The CRISPR-Cas9 system has two main components that introduce changes or mutations into DNA. One is the enzyme Cas9," Nikki replied, her eyes scanning the room, meeting her classmates' gazes. "It functions like molecular scissors, cutting both strands of DNA at a specific point in the genome, allowing bits of DNA to be added or removed."

"So how does it work?" Raine asked, her tone serious, testing both her student's understanding and her ability to handle future pupils.

"Well, Ma'am, it's guided to its target by an RNA molecule called guide RNA, which pairs with the complementary DNA sequence," Nikki explained, her voice slightly shaky. "Once aligned, Cas9 makes a double-strand break at that precise spot, and the cell repairs it. This repair process can be used to introduce mutations or insertions."

"And what are the implications of this? Not just for standard gene editing, but what about off-target effects?" Raine asked, leaning forward in her seat.

"One limitation of CRISPR-Cas9 is its potential for off-target effects," Nikki responded, gaining some confidence. "Sometimes, Cas9 cuts at unintended sites, which could cause genetic mutations with unknown consequences. Researchers are focused on refining guide RNA sequences and engineering modified Cas proteins to improve accuracy."

"Good," Raine said. "And what about the ethical considerations-how would you address the debate surrounding CRISPR's use in human germline editing?"

"The ethical concerns are substantial," Nikki replied. "Germline editing could result in unintended, heritable changes, raising issues like designer babies and the long-term genetic consequences."

"So what?" Raine pressed.

"While somatic cell editing holds therapeutic potential, germline editing could give rise to societal, ethical, and ecological issues we're not yet equipped to address," Nikki replied.

"About designer babies- are they good or bad?" one of the students asked, raising her hand.

"That's a great question, Ms. Del Valle," Nikki replied. "As you can see, these modified humans would have genes selected by their parents, nearly perfect genes, which could be passed down through generations. What happens if they overtake the natural human race? They might pose risks in the future, much like AI."

"Here's the case," Raine said, standing on her chair and pacing, her eyes now fixed on Nikki. "Gene editing might start with eliminating diseases, but over time, these perfectly healthy babies could lead to more and more designed children. Eventually, doctors may no longer be needed to cure diseases. These modified humans could become the new norm-people would be willing to spend vast sums just to create the ideal child society wants. What else can you all think of?" she added, gesturing to the silent class.

No one answered, and the room fell into an uneasy silence. "Ms. Watson, give me a number," Raine said suddenly.

"Se-" Nikki began.

"Seventeen! Of course. Your favourite number and your birth date, then," Raine replied.

"Yes, Ma'am. I was about to say seventeen," Nikki said, trying to comprehend how a professor she had just met knew not only her favourite number but also her birth date.

"Begin, Mr. Francisco," Raine snapped, tapping the man seated at the far right, the first in line.

"One," Mr. Francisco began, and the counting continued until it reached Ms. Dagñalan, one of the fifteen students she had aiming to master their degrees.

"Ms. Annassandra," Raine called.

The lady stood, hesitant at first, but eventually began to speak. "In aging," she said.

"What about it?" Raine asked.

"Scientists could also use gene editing to stop people from aging," Annassandra continued.

"Which would lead to..." Raine prompted, pointing to the lady seated next to Ms. Dagñalan.

"This would lead to more people occupying the planet," Ms. Cameron replied. Raine then pointed to the next person, continuing down the line until she reached the last student.

"Then overpopulation will occur," Mr. Zamora said.

"Maybe the scientists will also find a way to reverse aging," another student suggested.

"We could even borrow genetic traits from other species," one added. "For instance, bioluminescence from fireflies."

"We might just figure out a way to live forever. But where would we live? We might stop having new generations altogether because of that!"

"It could also be beneficial," another student countered. "If those genetically modified humans are immune to diseases, we could explore space further-maybe even without oxygen or space suits."

"We might also explore the deepest oceans and soar into the skies," another added.

"Even now, people who find out their children have a disease that will cause them to suffer in the future, or affect future generations, consider abortion. What happens when those children are designed to be perfect? We might end up seeing genetically modified individuals as the most powerful in society."

After the round of fourteen on-the-spot answers, the conclusion was handed over to the reporter.

"Nowadays, CRISPR is still in development," Nikki said. "The things we've discussed-things that could happen-are possible, but probably not for a while. There's still so much to explore, and with every decision we make, especially when this becomes accessible to the public, we must consider the ethical implications."

After a long, tiring day, Raine finally made it back to her flat. Little did she know, something was already unfolding with Zane at the hospital. After a brief rest and a well-deserved dinner, she returned to the problem that had been plaguing her thoughts-the new case from an anonymous client.

"Could it be?" she muttered, making her way down the hallway towards the two bathrooms, then turning into the small area beside the study. This was a room only she could access, secured by a key she alone guarded.

She opened the door, revealing a wall covered with pictures of the latest victim in a mysterious case. At the center of the bulletin board was the woman-of mixed American and Filipino descent, with white skin, brown hair, and striking blue eyes.

Other photos showed a modest house in the province, the victim's body found lying peacefully on her bed, the items discovered inside her humble home, and a peculiar rope hanging from the ceiling. The loop at the end was not the traditional kind used for hanging, adding an unsettling element to the scene.

She sat in front of the bulletin board, lighting the candles she had placed there the previous day after receiving the request from the anonymous caller. It was the same moment she'd also received a message from the dean of graduate studies, informing her that the master's program would resume the following day-exactly now.

Closing her eyes, she tried to recall the scene when she, along with the other police and forensic investigators, had visited the house at seven in the evening.

She once again pictured herself at the scene. The sun had already set as they entered the house, with only a few street lights flickering along the two-way roads. The house sat on a flattened part of a hill, surrounded by a vast field and overgrown plants. Three other houses dotted the hill, all spaced far apart, with only two situated close enough to share a small distance-still, they were far from the victim's home.

"Amara Cruz Turner," said Detective Inspector Ferrer as they stepped inside. The other officers were already inside, examining the body. "A 29-year-old dual citizen, Filipino-American. According to our investigation, she was a novel writer specializing in folklore and cultural studies."

"It seems like she was dedicated to her novels, huh?" said Alie Madrazo, greeting them as she passed by into the room.

Ahead of them was the bedroom, where the body of the female victim lay. "Time of death will still be identified later," said Christopher, one of the forensic analysts Raine worked with.

Raine noticed the candles, their soft glow eerily mirroring their position in her own flat. White candles were arranged in a circle around the room. The woman's eyes were closed, giving the impression she had passed peacefully. Yet, there was a faint, unsettling expression on her face-one that suggested she had seen something startling in her final moments.

Aside from this, the body showed no external injuries. There were no signs of a struggle or restraint, and no apparent cause of death.

Raine snapped her fingers, bringing herself back to reality-the darkness of her room now surrounding her. Just then, her phone rang, the familiar buzzing sound drawing her attention. She reached down to the floor, her fingers brushing against the device, noticing the unknown number once more.

A grin tugged at the corners of Raine's lips as she waited for the caller to speak. "Hello, Ms. L. A. V.," said the caller.

"I know who sent you," she said, her voice steady.

"Mmhmm? You sure about that?" the woman on the other end of the line asked, her tone intrigued.

"And tell whoever they are that I'm starting to get interested in solving the case," Raine continued. "Tell them, I'm taking it."

"Great! Your client will be delighted!" the woman replied with a hint of excitement.